Nowa mutacja COL1A1 we wczesnej hiperostozie korowej niemowlęcia (choroba Caffeya) rozszerza spektrum zaburzeń związanych z kolagenem ad 7

Jednak badania densytometryczne kości u chorego dorosłego pacjenta (IV-2) okazały się być prawidłowe, a podobne wartości złamań mogą wystąpić w normalnej populacji (45). Niemniej jednak, zdrowie kości z rodzin ADC wymaga dalszych badań, ponieważ zdjęcia rentgenowskie wykonane podczas epizodów hiperostozy korowej pokazują, że nieprawidłowości w kości korowej i końcowej towarzyszą bardziej oczywistemu powstawaniu podokostnowej nowej kości. Podsumowując, ADC jest związane z mutacją w COL1A1, a zatem należy do rodziny stanów kolagenowych typu I, które obejmują osteogenezę typu imperfecta I (IV) (46); Zespół Ehlersa-Danlosa typy I (31) i VII (47,48) oraz recesywna forma zastawek serca (49); idiopatyczna osteoporoza (50); przecięcia tętnic (51); i protuberany dermatofibrosarcoma, co stwierdzono, że jest związane z translokacją pomiędzy chromosomami 17 i 22 prowadzącymi do wytworzenia białka fuzyjnego składającego się z kolagenu A (I) i PDGF-a. (52). Odkrycia w niniejszym badaniu rozszerzają fenotypowe spektrum zaburzeń związanych ze zmianami genetycznymi w genach kolagenu typu I tak, aby obejmowały zaburzenie hiperostotyczne, ale nie jest pewne, w jaki sposób mutacja R836C prowadzi do czasowo i przestrzennie ograniczonego defektu kości. Metody Rodziny z ADC. Ustalono dużą, trzecią generację kanadyjskiej rodziny ADC (rodzina 1), a szczegóły historyczne dotyczące epizodów infekcyjnej korowej przełyku uzyskano od członków rodziny. Wcześniejsze doniesienia na temat tej rodziny zawierały także szczegółowe informacje o wszystkich epizodach możliwej infekcyjnej korowej przełyku (7, 8). Te źródła informacji zostały połączone w celu potwierdzenia przypisania chorób w rodowodzie. Na potrzeby analizy powiązań genetycznych, osoby z tej rodziny zostały oznaczone jako dotknięte chorobą, jeśli miały potwierdzoną radiologicznie chorobę Caffey a (członkowie dotknięci chorobą) lub jeśli mieli dzieci z rozpoznaniem choroby Caffeya (nosiciele obowiązkowi). Genomowy DNA od 24 takich osób był dostępny do badań. Niepowiązani małżonkowie zostali uznani za nienaruszonych. Oprócz rodziny 1, ustalono dwie dodatkowe małe rodziny (rodziny 2 i 3), które miały odpowiednio 3 i 2 członków dotkniętych chorobą. Mała rodzina kanadyjska (rodzina 2) obejmowała matkę i jej 2 dzieci (patrz Figura 2C), u których choroba Caffeya była klinicznie i radiologicznie (patrz Figura 1), podczas gdy mała australijska rodzina (rodzina 3) składała się z dotkniętych bliźniąt jednojajowych , zdrowy brat i zdrowi rodzice (patrz rysunek 2D) (19). Pojedynczy sporadyczny przypadek miał hiperostozę żebra, co było prawdopodobnie spowodowane ADC. Ponadto zbadano 2 sporadyczne przypadki cięższej prenatalnej postaci choroby Caffey a (20, 21). Autoosomalne recesywne dziedziczenie postulowano w przypadkach prenatalnych (21). Otrzymano szczegółowe informacje od wszystkich rodzin na temat możliwych zdarzeń, które mogły wywołać epizody dziecięcej hiperostozy korowej. Pytania te zostały podjęte wkrótce po wystąpieniu epizodów hiperostozy korowej u dzieci dotkniętych chorobą w rodzinach 2 i 3, a także u niektórych niedawno dotkniętych chorobą członków dużej rodziny 1. Długotrwałe następstwa tego stanu klinicznego dotkniętych osób i na obligatoryjnych przewoźników zostały określone. Obserwowano także długoterminowe cechy kliniczne osób z każdej rodziny, które nie nosiły allelu Caffey. Badania genetyczne i analiza DNA. W rodzinie wykonano skan całego genomu z markerami mikrosatelitarnymi rozmieszczonymi w odstępach około 10 centymorganów (zestaw Webber 9, Invitrogen Corp.), a następnie dokładne mapowanie przy użyciu dostępnych na rynku markerów dla połączonego przedziału. Wykonaliśmy obliczenia wyniku LOD za pomocą programu Mlink (http://linkage.rockefeller.edu/) zakładając częstotliwość choroby równą 0,1%, równe częstotliwości alleli i dziedziczenie autosomalne dominujące z pełną penetracją. Geny kandydatów w połączonym regionie zostały zidentyfikowane i zsekwencjonowane przez Massachusetts General Hospital Sequencing Core przy użyciu zestawów do sekwencjonowania cyklicznego Applied Biosystems Taq DyeDeoxy Terminator. Po zidentyfikowaniu domniemanego genu Caffey i jego mutacji, przebadaliśmy genomowy DNA przed dotkniętymi chorobą osobnikami i obligatoryjnymi nosicielami różnych rodzin, a także sporadycznymi przypadkami i kontrolami, poprzez mapowanie restrykcyjne produktów PCR. W tych badaniach wykorzystano przedni primer AGCAGGGGAATATGGGTCAG i starter odwrotny GGCCCTGAGAAAAACCATC do wytworzenia produktu PCR o długości 495 bp. Zmutowany produkt PCR nie posiadał miejsca cięcia dla endonukleazy restrykcyjnej HpyCH4IV, co umożliwiło wykrycie mutacji przez elektroforezę w żelu agarozowym po enzymatycznym trawieniu zamplifikowanego DNA (prążki typu dzikiego, 259, 60 i 176 pz; , pasma 319 i 176 bp, zauważ, że pasmo 60 bp nie jest pokazane na Figurze 2B)
[patrz też: miód nawłociowy właściwości lecznicze, jakie spodnie do biegania, zapalenie gardła u dzieci ]
[przypisy: jakie spodnie do biegania, fazy choroby alkoholowej, przepuklina brzuszna pooperacyjna ]